Construction of an acellular spinal cord scaffold with a novel NT-3 sustained-release system promotes the neural differentiation of BMSCs through the NT-3/TrkC pathway

NT-3 can effectively promote the differentiation of bone marrow mesenchymal stem cells (BMSCs) into neurons and is usually used in spinal cord injury repair, which is conducive to the recovery of motor and sensory functions.^1,2 In the early stage, we constructed NT-3 cross-linked scaffolds with a three-dimensional mesh structure, good moisture content, and extremely low immunogenicity, which can sustain the release of NT-3 for 35 days;^3–5 they also have good biocompatibility and can promote the differentiation of BMSCs into neurons.⁵ 

NT-3 cross-linked scaffolds can promote the differentiation of BMSCs into neurons, but the molecular mechanism is not clear.⁵ Previous studies have shown that TrkC exhibits tyrosine kinase activity when bound to NT-3, forming the NT-3/TrkC signaling pathway that regulates the differentiation of the peripheral and central nervous systems.^6–8 NT-3/TrkC promotes cell proliferation and differentiation by activating the downstream MAPK/ERK and PI3K/AKT pathways.^9,10 Lai et al.¹¹ demonstrated that NT-3 promotes neural stem cell differentiation into neurons and neurological recovery via the NT-3/TrkC signaling pathway. Wang et al.¹² showed that BMSCs were synergistically activated downstream of the PI3K/AKT and MAPK/ERK signaling pathways in composite scaffolds. Therefore, we hypothesized that NT-3 promotes the differentiation of BMSCs into neurons via NT-3/TrkC on the NT-3 cross-linked scaffold.

NT-3 cross-linked scaffolds can release NT-3 slowly for 35 days, but there is low drug loading and “violent release” on the first day.⁵ We also hypothesized that NT-3, as a target molecule in the NT-3 cross-linked scaffold, promotes the differentiation of BMSCs into neurons. Therefore, it is necessary to improve the preparation method so that the scaffold can be loaded with more NT-3. Heparin molecules have negatively charged groups, which can have strong electrostatic interactions with protein molecules such as growth factors. Therefore, heparin can adsorb growth factors to achieve a sustained-release effect.^13,14 Therefore, we aimed to use heparin and EDC/NHS together as a cross-linking agent to construct an NT-3 improved scaffold. It was reasonably concluded that NT-3, as a target molecule, may mediate the NT-3/TrkC pathway and promote BMSC differentiation into neurons on NT-3 cross-linked scaffolds. By improving the NT-3 cross-linking protocol, scaffolds loaded with more NT-3 are more conducive to BMSC differentiation and spinal cord repair.

Referring to the previous preparation method,^4,5 the fresh spinal cord was extracted from the thorax vertebra of SD rats. The decellularized spinal cord scaffolds were obtained by a combination of repeated freeze‒thawing, rinsing with ultrapure water, chemical extraction, and cross-linking treatment. The scaffolds were reacted with 2 μg/ml NT-3 (PEPROTECH, USA) by the EDC chemical cross-linking method for 1 h. The NT-3 cross-linked scaffold was obtained by repeated rinsing, freeze-drying, sterilization by Co-60 16 Gy irradiation, and storage at −20 °C.

RT‒PCR and WB techniques were used to analyze mRNA and protein expression during BMSC differentiation into neuron-like cells on NT-3 cross-linked scaffolds. NF-200 and MAP-2, two neuronal marker proteins, are commonly used to detect the differentiation of neuronal cells.^15–18 To investigate the effect of NT-3 cross-linked scaffolds on neural differentiation, the following neurotrophin-related tyrosine kinase inhibitors were used: the NT-3/TrkC inhibitor K252a (200 nM, Merck, K2015-200UL), the recombinant human TrkC-Fc Chimera (TrkC-Fc: 0.1 μg/ml, R&D), the MEK/ERK inhibitor U0126 (20 μM, Cell Signaling Technology), and the PI3K inhibitor LY294002 (5 μM, Cell Signaling Technology).¹¹ 

First, equal weights of NT-3 cross-linked scaffolds were cut, laid flat, and glued in six-well plates with tissue adhesive (Cat No. LOT215503N1; B. BRAUN AG). The scaffolds were prewetted with DMEM/F12 for 0.5 h before cell seeding. A BMSC cell suspension (20 μl containing 4 × 10⁵ cells) was inoculated in the wells containing the scaffolds, followed by incubation for 2 h at 37 °C and 5% CO₂ in a humid atmosphere. Then, 3 ml of cell culture solution [DMEM/F12 (HyClone, USA) containing 10% FBS (HyClone, USA)] was added. The scaffolds were warmed for 72 h. Afterward, the medium was replaced with a synthetic medium composed of low-glucose DMEM (HyClone, USA) with 2% FBS (HyClone, USA) and 1% penicillin‒streptomycin (HyClone, USA), with a volume of 3 ml per well; inhibitors were included as described below, and the medium was changed once every 2 days by replacing half of the volume. After 7 days, the cells in six-well plates were washed, detached with trypsin, and then subjected to real-time PCR and WB analysis.

The subgroups were treated with inhibitors as follows:

• Group 1: NT-3 cross-linked scaffold + synthetic medium + blocking agent (K252a).

• Group 2: NT-3 cross-linked scaffold + synthetic medium + blocking agent (TrkC-Fc).

• Group 3: NT-3 cross-linked scaffold + synthetic medium + blocking agent (U0126).

• Group 4: NT-3 cross-linked scaffold + synthetic medium + blocking agent (LY294002).

• Group 5: NT-3 cross-linked scaffold + synthetic medium.

For PCR, cells were washed from NT-3 cross-linked scaffolds in six-well plates, and the corresponding RNA was extracted using TRIzol (GeneCopoeia, USA). The PrimeScript^™ RT reagent Kit (Perfect Real Time) (TAKARA, USA) was used for DNA synthesis using 1 mg of total RNA. TB Green^® Premix Ex Taq^™ II (Tli RNaseH Plus) (TAKARA, USA) was used for PCR: the samples were first predenatured at 95 °C for 30 s and then cycled at 95 °C for 5 s and 60 °C for 30 s for a total of 40 cycles. A QuantStudio 7 Flex qPCR system (Thermo Fisher) was used.

For WB, cells washed from NT-3 cross-linked scaffolds were added to SDS lysis buffer (P0013G, Beyotime), and the supernatant was collected. After measuring the protein concentration with a BCA kit (Beyotime), the protein concentration was adjusted to 2 mg/ml, and the sample was mixed with 5× loading buffer and boiled at 100 °C for 5 min. After centrifugation, the supernatant containing the protein was loaded into each lane. After electrophoresis, transfer buffer was used to transfer the protein onto PVDF membranes. The membranes were then treated with Protein Free Rapid Closure Solution (Beyotime). After blocking, the membranes were incubated overnight at 4 °C with primary antibodies, including antibodies against NF-200 (1:500 Abcam, CA, UK, Cat No. ab82259) and MAP-2 (1:5000 Abcam, CA, UK Cat No. ab92434). The cells were washed 5 times with Tris-buffered saline–Tween-20 (TBST) for 5 min each and incubated with horseradish peroxidase (HRP)-labelled goat anti-rat IgG (H + L) (1:1000; Beyotime) for 1 h at 37 °C. After washing five times with TBST for 10 min each time, the membranes were immersed in a chemiluminescent substrate solution (ChemistarTM ECL High-Sig ECL Western blotting Substrate, Tanon) for 1 min and subjected to chemiluminescence analysis (Tanon 4600). GAPDH was used as an internal reference control. Relative protein expression was defined as the ratio of the gray value of the target band to the gray value of the internal reference.

Heparin methylpropionate (HepMA) was configured with a Heparin Methacryloyl Kit (EFL-HepMA-001): 0.25% photoinitiator LAP was configured with PBS, and 4% (w/v) HepMA was configured with the LAP liquid.

The mixed cross-linking solution was configured as follows: 4% HepMA and 2% EDC/NHS (5:2, w/v) were mixed in equal volumes as the cross-linking solution.

According to the theoretical basis that NT-3 mediates the NT-3/TrkC pathway to promote the differentiation of BMSCs into neurons, it is necessary to improve the drug loading of NT-3. The NT-3 improved scaffolds were prepared as follows: the acellular spinal cord scaffold was immersed in the mixed cross-linked solution for 1 h and then soaked again with NT-3 (2 ng/ml) for 1 h (at room temperature, away from light) and irradiated with a 405 nm light source for 30 s. Then, the scaffold was removed, freeze-dried, and stored in a −20 °C refrigerator.

To verify the performance of the NT-3 improved scaffolds, we used the NT-3 cross-linked scaffold as a control scaffold.

The NT-3 improved scaffolds and controls were freeze-dried and then photographed in gross form. Next, the NT-3 improved scaffolds and control group were fixed with 20 g/L glutaraldehyde, exposed to the observation surface, dehydrated with gradient concentrations of ethanol, immersed in tert-butanol, subjected to critical point drying, and sprayed with gold to observe its ultrastructure by scanning electron microscopy.

The moisture content of the NT-3 improved scaffolds and controls was determined via the following steps (n = 5).¹⁹ Each scaffold was weighed at W0, and the scaffold was immersed in PBS (pH 7.4, 37 °C) for 24 h. After careful removal of the surface medium, the weight was recorded as W1, and the scaffold moisture content was calculated as (W1 − W0)/W0 × 100% (the length of the scaffolds was 2 cm).

To evaluate the capacity for sustained release of NT-3 in vitro, we performed the following steps.²⁰ In an ultraclean laminar flow table, the 2-cm NT-3 improved scaffolds and control scaffolds were placed into wells in a 24-well plate under aseptic conditions (one scaffold in each well for a total of six wells). DMEM/F12 (0.5 ml; HyClone, USA) was added to the wells with a scaffold, and 0.5 ml of PBS was added to the blank wells to reduce the vaporization of the scaffold release solution. 0.5 ml of medium was collected, and then, the same volume of fresh medium was added at different time points (days 1, 4, 7, 14, 21, 28, and 35 after the scaffolds were immersed in the medium). The NT-3 sustained-release medium was placed in a −20 °C refrigerator. After collection, all NT-3 sustained-release medium was step-thawed and stored in 4 °C refrigerators, and all samples and standards in the NT-3 ELISA kit (Reddot Biotech, RDR-NT3-Ra) were placed at room temperature. NT-3 sustained-release medium was used according to the ELISA kit instructions. Finally, the result was read at 450 nm on Spectra Max M2 (Molecular Devices).

The NT-3 improved scaffolds and controls were cut and placed in confocal focusing dishes with equal weight. BMSC suspensions (50 µl, 4.0 × 10⁵/ml) were injected on the surface and inside the scaffolds. The cell culture solution (DMEM/F12 + 10% FBS +1% penicillin‒streptomycin) was added around the scaffold and incubated for 10 h. The composite material of the scaffold and cells was rinsed with PBS three times, fixed at room temperature with 4% paraformaldehyde for 30 min, and then rinsed with PBS three times. Each well was incubated with 500 µl DAPI for 5 min, and cell adhesion was observed by laser confocal microscopy (Leica, SP5).

According to the above methods, the NT-3 improved scaffolds and controls were divided into three groups, which were cultured in 48-well plates, and 1 ml cell culture solution was added. The liquid was changed every 24 h. At the 24, 48, and 72 h time points, 10% CCK-8 (DOJINDO, CK04) was added to each group and cultured for 2 h, and 100 μl of the corresponding culture medium was transferred to a 96-well plate to determine the OD value. The result was read at 450 nm on Spectra Max M2 (Molecular Devices).

According to the above methods, the NT-3 improved scaffolds and controls were divided into three groups and cultured in six-well plates with equal weight, and 2 ml of cell culture solution was added for 72 h. Then, 2 ml of synthetic medium was added per well. The liquid was changed every 2 days. After 7 days, the cells in the six-well plate were trypsinized and filtered for real-time PCR analysis.

BMSCs were treated with synthetic medium containing 0.5 ng/ml NT-3 for 7 days, and the medium was changed every 2 days for 7 days. The cells were collected as a standard group. Cells collected from the NT-3 improved scaffolds and controls in six-well plates were compared with standard group cells. TRIzol (TAKARA, USA) was used to extract RNA from cells. The kit instructions were followed to synthesize DNA with 1 mg RNA [ABScript Neo RT Master Mix for qPCR with gDNA Remover (ABclonal, RK20433, China)]. 2×Universal SYBR Green Fast qPCR Mix (ABclonal, RK21203, China) was used for PCR analysis.

Using the RT‒PCR system (Roche Cobas z 480), the following protocol was used: denaturation at 95 °C for 3 min, followed by 45 cycles of 95 °C for 5 s, 60 °C for 20 s, and 72 °C for 34 s. The expression level of the GAPDH gene was used as the internal control.

The PCR primers used are as follows:

• NTRK3 (TrkC)

• Forward primer: CTCTACACGGGACTCCAGAAG

• Reverse primer: GGTGAGCCGGTTACTTGACA

• Mtap2 (MAP-2)

• Forward primer: GCCAGCCTCAGAACAAACAG

• Reverse primer: AAGGTCTTGGGAGGGAAGAAC

• Nefh (NF-200)

• Forward primer: GAAACACCAAGTGGGAGATGG

• Reverse primer: GAGCTTTCTGTAAGCGGCAAT

• GAPDH

• Forward primer: AATGGATTTGGACGCATTGGT

• Reverse primer: TTTGCACTGGTACGTGTTGAT

According to the above method (culture method in step 2), the NT-3 improved scaffolds and controls were divided into four groups and cultured in 24-well plates with equal weight, and 0.5 ml of cell culture solution was added for 72 h. After 7 days of cultured synthetic medium replacement, the scaffold with cells was rinsed with PBS and fixed in PBS with 4% formaldehyde for 20 min. The tissue was cut into 10 μm slices using a slicing machine (Leica, RM2255). These were then dipped in 0.1% Triton-X-100 for 3 min and washed with PBS. The treated samples were incubated with primary antibodies against NF-200 (1:200) (Abcam, CA, UK, Cat No. 5; ab82259) or MAP-2 (1:200, CA, UK) (Ab11267) overnight at 4 °C. Excess primary antibody was removed by three washes in PBS at room temperature. The samples were then incubated with a secondary antibody for 4 h: Andy FluorTM 647 goat anti-rabbit IgG (H + L) antibody (L126A, GeneCopoeia, USA). DAPI was used to stain the nucleus. The negative control used was PBS (PBS instead of primary antibody) + the corresponding secondary antibody for the NT-3 improved scaffolds and controls. Laser confocal microscopy (Leica, SP5) was used. The differentiation of BMSCs into neuron-like cells between the two scaffolds was compared. The fluorescence intensity of neuron-like cells was analyzed by the LAS software (IPP20, Leica Application).

Data are expressed as x ± s. The SPSS 19.0 statistical software was applied. One-way ANOVA, two groups of repeated measures ANOVA, and t-test were used. p < 0.05 indicates a difference with statistical significance.

RT‒PCR was performed to study gene expression during BMSC differentiation toward neuron-like cells on NT-3 cross-linked scaffolds. Two key neuronal cell-associated marker proteins, NF-200 and MAP-2, are frequently used to detect associated neuronal differentiation.²¹ The 2^−△△Ct values were positively correlated with high gene expression by RT‒PCR.

To evaluate the mRNA levels of the neural marker NF-200, we chose scaffolds without the addition of blocking agents as controls. When the inhibitors K252a and TrkC-Fc were added, NF-200 gene expression decreased obviously [Fig. 1(A-a) vs Fig 1(A-e) 1.109 33 ± 0.107 006 vs 5.406 67 ± 0.152 33, n = 3, P < 0.0001; Fig. 1(A-b) vs Fig 1(A-e) 1.699 ± 0.104 886 vs 5.406 67 ± 0.152 33, n = 3, P < 0.0001]. The results showed that the effects of the inhibitors K252a and TrkC-Fc on NF-200 gene expression in the scaffolds were statistically significant but not biologically significant [Figs. 1(A-a) and 1(A-b) 1.109 33 ± 0.107 006 vs 1.699 ± 0.104 886, n = 3, P < 0.0001]. When the inhibitors U0126 and LY294002 were added, NF-200 gene expression decreased slightly [Fig. 1(A-c) vs Fig. 1(A-e) 2.700 33 ± 0.154 368 vs 5.406 67 ± 0.152 33, n = 3, P < 0.0001; Fig. 1(A-d) vs Fig. 1(A-e) 2.729 ± 0.165 375 vs 5.406 67 ± 0.152 33, n = 3, P < 0.0001]. The results revealed that the changes in NF-200 gene expression in scaffolds were not statistically or biologically significant between U0126 and LY294002 treatments [Figs. 1(A-c) and 1(A-d) 2.700 33 ± 0.154 368 vs 2.729 ± 0.165 375, n = 3, P > 0.05].

To investigate the mRNA levels of the neural marker MAP-2, we also chose scaffolds without the addition of blocking agents as controls [Fig. 1(B-e) 4.72 ± 0.062 65, n = 3]. When the blockers K252a or TrkC-Fc were added, MAP-2 gene expression decreased obviously [Fig. 1(B-a) vs Fig. 1(B-e) 1.01 ± 0.026 vs 4.72 ± 0.062 65, n = 3, P < 0.0001; Fig. 1(B-b) vs Fig. 1(B-e) 1.464 67 ± 0.045 938 vs 4.72 ± 0.062 65, n = 3, P < 0.0001]. The results showed that the changes in MAP-2 gene expression in the scaffold treated with K252a and TrkC-Fc were statistically significant but not biologically significant [Fig. 1(B-a) vs Fig. 1(B-b) 1.01 ± 0.026 vs 1.464 67 ± 0.045 938, n = 3, P < 0.0001]. When the inhibitors U0126 and LY294002 were added, MAP-2 gene expression decreased slightly [Fig. 1(B-c) vs Fig. 1(B-e) 2.445 67 ± 0.040 253 vs 4.72 ± 0.062 65, n = 3, P < 0.0001; Fig. 1(B-d) vs Fig. 1(B-e) 2.444 33 ± 0.111 648 vs 4.72 ± 0.062 65, n = 3, P < 0.0001]. The results showed that there was no statistical or biological significance in MAP-2 gene expression between U0126 and LY294002 treatments [Figs. 1(B-c) vs 1(B-d) 2.445 67 ± 0.040 253 vs 2.444 33 ± 0.111 648, n = 3, P > 0.05].

When different blocking agents were added, NF-200 or MAP-2 gene expression decreased to varying degrees [Figs. 1(A) and 1(B)]. After blocking the NT-3/TrkC signaling pathway (K252a and TrkC-Fc), the mRNA levels were significantly decreased. After MAPK/ERK or PI3K/AKT inhibition (U0126 and LY294002), the mRNA levels were decreased slightly. Therefore, in contrast to blocking the MAPK/ERK or PI3K/AKT pathway, blocking the NT-3/TrkC signaling pathway can effectively block neuronal differentiation.

To investigate the relative protein expression levels of the neural marker NF-200, we used the NT-3 cross-linked scaffolds without any blocking agents as a control [Fig. 2(A-G5) 1.5467 ± 0.0611, n = 3]. When the blocker K252a or TrkC-Fc was added to the scaffolds, NF-200 protein expression decreased obviously [Fig. 2(A-G1) vs Fig. 2(A-G5) 0.58 ± 0.07 vs 1.5467 ± 0.0611, n = 3, P < 0.0001; Fig. 2(A-G2) vs Fig. 2(A-G5) 0.5667 ± 0.060 28 vs 1.5467 ± 0.0611, n = 3, P < 0.0001]. When the inhibitor U0126 or LY294002 was added to the scaffolds, NF-200 protein expression decreased slightly [Fig. 2(A-G3) vs Fig. 2(A-G5) 1 ± 0.1253 vs 1.5467 ± 0.0611, n = 3, P < 0.0001; Fig. 2(A-G4) vs Fig. 2(A-G5) 1.0067 ± 0.096 09 vs 1.5467 ± 0.0611, n = 3, P < 0.0001]. The results revealed that there was no statistical or biological significance in the expression of NF-200 protein between K252a and TrkC-Fc treatments [Fig. 2(A-G1) vs Fig. 2(A-G2) 0.58 ± 0.07 vs 0.5667 ± 0.060 28, n = 3, P > 0.05] or between U0126 and LY294002 treatments [Fig. 2(A-G3) vs Fig. 2(A-G4) 1 ± 0.1253 vs 1.0067 ± 0.096 09, n = 3, P > 0.05].

The relative protein expression of MAP-2 was similar to that of NF-200. We used the NT-3 cross-linked scaffolds without any blocking agents as a control [Fig. 2(B-G5) 2.6133 ± 0.055 08, n = 3]. When the inhibitor K252a or TrkC-Fc was added to the scaffolds, MAP-2 protein expression decreased obviously [Fig. 2(B-G1) vs Fig. 2(B-G5) 1.17 ± 0.0755 vs 2.6133 ± 0.055 08, n = 3, P < 0.0001; Fig. 2(B-G2) vs Fig. 2(B-G5) 1.07 ± 0.04 vs 2.6133 ± 0.055 08, n = 3, P < 0.0001]. When the inhibitor U0126 or LY294002 was added to the scaffolds, MAP-2 protein expression decreased slightly [Fig. 2(B-G3) vs Fig. 2(B-G5) 2.22 ± 0.131 15 vs 2.6133 ± 0.055 08, n = 3, P < 0.0001; Fig. 2(B-G4) vs Fig. 2(B-G5) 2.14 ± 0.060 83 vs 2.6133 ± 0.055 08, n = 3, P < 0.0001]. The difference in MAP-2 protein expression was also not statistically or biologically significant between the scaffolds treated with K252a and TrkC-Fc [Fig. 2(B-G1) vs Fig. 2(B-G2) 1.17 ± 0.0755 vs 1.07 ± 0.04, n = 3, P > 0.05] or between U0126 and LY294002 [Fig. 2(B-G3) vs Fig. 2(B-G4) 2.22 ± 0.131 15 vs 2.14 ± 0.060 83, n = 3, P > 0.05].

In summary, after treatment of NT-3 cross-linked scaffolds with different inhibitors, the protein expression results from the WB assay correlated positively with the PCR results. For blocking neuron differentiation, the NT-3/TrkC signaling pathway may be more effective than the MAPK/ERK or PI3K/AKT signaling pathways. Some scholars²¹ have also verified that NT-3/TrkC is located upstream and promotes the differentiation of BMSCs into neurons via downstream PI3K and MAPK in parallel. Regarding the molecular mechanisms of regulation, NT-3/TrkC is located upstream and can regulate differentiation through NT-3 or TrkC.⁶ Some scholars^22,23 have also regulated the membrane receptor TrkC, enhancing the binding efficiency of NT-3 to promote the differentiation of seed cells into neurons and promote spinal cord injury repair. NT-3 can be used as a target protein to improve the neural differentiation performance of NT-3 cross-linked scaffolds by improving the drug loading of NT-3. This is the theoretical basis for constructing the NT-3 improved scaffolds.

We used EDC/NHS and methylpropionylated heparin as cross-linking solutions to successfully construct NT-3 improved scaffolds. Both the NT-3 improved scaffolds and the controls were white, cylindrical, and intact in shape [Fig. 3(A): a, control group; b, NT-3 improved scaffold]. There was no significant difference in the moisture content between the NT-3 improved scaffolds and the controls [Fig. 3(B) 2.45 ± 0.18 vs 2.49 ± 0.19, n = 5, P > 0.05]. Scanning electron microscopy (SEM) was used to observe the internal structure of the NT-3 improved scaffolds [Fig. 3(C)] and the controls [Fig. 3(D)]; they are shown as internal three-dimensional network structures.

Both NT-3 improved scaffolds and controls are built on the basis of extracellular matrix (ECM) scaffolds. In the process of ECM scaffold decellularization, many cells and immunogenic molecules are removed, while most structural proteins and macromolecules are mostly preserved. Thus, the ECM scaffold simulates an optimal nonimmune environment with a natural three-dimensional structure and a variety of bioactive ingredients.²⁴ ECM provides an ideal biomaterial for tissue repair, such as the heart, spinal cord, lungs, and liver.²⁵ During the preparation of ECM scaffolds, it is crucial to decellularize thoroughly and to retain ECM components completely.⁵ We used a composite scheme of chemical extraction, freeze‒thawing, and cross-linking to prepare a relatively perfect spinal cord ECM scaffold.⁴ At the same time, this scaffold also provides raw materials for 3D bioprinting and organoid research, which has a high research value.

According to the NT-3 sustained-release analysis [Fig. 4(C)] of the NT-3 improved scaffolds and the controls, the NT-3 improved scaffolds showed higher NT-3 release than the controls at the same time point within 35 days [Fig. 4(C)]. There was no significant “NT-3 sudden-release” phenomenon on the first day of the NT-3 improved scaffolds. For the NT-3 improved scaffolds, ∼1.6 ng of NT-3 was released on the first day (maximum release) and was steadily released during the later period. For the control scaffolds, ∼0.5 ng of NT-3 was released on the first day (maximum release), and the release decreased sharply in the later period, showing insufficient drug loading [Fig. 4(C)]. BMSCs were attached to the NT-3 improved scaffolds [Fig. 4(A)] and the controls [Fig. 4(B)], and cell growth was observed by confocal microscopy after 10 h. The proliferation of BMSCs with NT-3-improved scaffolds was significantly improved than that of the controls at 24 h [Fig. 4(D) 0.46 ± 0.02 vs 0.50 ± 0.01, P < 0.01, n = 6], 48 h [Fig. 4(E) 0.74 ± 0.07 vs 1.11 ± 0.19, P < 0.01, n = 6], and 72 h [Fig. 4(F) 1.01 ± 0.12 vs 1.49 ± 0.15, P < 0.0001, n = 6]. The NT-3-improved scaffolds were more conducive to BMSC proliferation than the controls.

The NT-3/TrkC signaling pathway of the NT-3-improved scaffolds and controls promoting the differentiation of BMSCs into neurons was studied. The mRNA levels of target proteins, such as TrkC, NF-200, and MAP-2, were analyzed. Compared with the controls, for TrkC [Fig. 5(A)], the RQ value of NT-3-improved scaffolds was the largest (5.25 ± 0.17 vs 2.09 ± 0.14, n = 3, P < 0.0001). For NF-200 [Fig. 5(B)], the RQ value of the NT-3-improved scaffolds was the largest (5.59 ± 0.26 vs 2.33 ± 0.19, n = 3, P < 0.0001). For MAP-2 [Fig. 5(C)], the RQ value of the NT-3-improved scaffolds was the largest (5.04 ± 0.05 vs 2.11 ± 0.23, n = 3, P < 0.0001). These results indicated that the NT-3-improved scaffolds, compared with the controls, can sustainably release more NT-3 and more effectively induce the transcription of TrkC, NF-200, and MAP-2.

After 7 days of culturing BMSCs on the NT-3 improved scaffolds and controls, BMSCs gradually grew neuronal cell-like synapses, which increased significantly over time. Under NF-200 and MAP-2 staining, MSCs were positively expressed on the NT-3 improved scaffolds and controls, with the more pronounced fluorescence intensity indicating a higher degree of differentiation. For the NF-200 antibody (Fig. 6), the immunofluorescence intensity of the NT-3-improved scaffolds was greater than that of the control scaffolds [Fig. 6(A) vs Fig. 6(C) 66.6475 ± 16.454 84 vs 35.52.32 ± 2.599 12, n = 4, P < 0.0001], and both were statistically significant [Fig. 6(E)]. For the MAP-2 antibody (Fig. 7), the immunofluorescence intensity of the NT-3-improved scaffolds was greater than that of the control scaffolds [Fig. 7(A) vs Fig. 7(B) 45.3675 ± 4.213 29 vs 24.4500 ± 2.753 35, n = 4, P < 0.0001], of which both were also statistically significant [Fig. 7(E)]. These results indicate that the NT-3-improved scaffolds facilitated BMSC differentiation toward neurons.

NT-3 can be used as a molecular target for slow-release materials to regulate the differentiation of BMSCs into neurons. Therefore, we initially constructed NT-3 cross-linked scaffolds through EDC/NHS cross-linking. However, we found that NT-3 had a low drug loading and “burst release” on the first day, so the cross-linking method needed to be improved. Heparin can adsorb growth factors and improve their biological stability, which can be used to construct multifunctional biomaterials.²⁶ Cai et al.²⁷ also used EDC/NHS and heparin sodium to jointly construct a heparin-induced decellularized scaffold for HGF sustained release, which realized a high-efficiency drug loading and long-term sustained release of HGF. Hettiaratchi et al.^28,29 anchored BMP-2 to biological materials by methylpropanamide heparin particles and achieved long-term and efficient controlled release of BMP-2, reduced the side effects of BMP-2, and effectively promoted the repair of bone defects. Pruett et al.³⁰ achieved controlled release of growth factors on biomaterials through heparin particles, significantly improving wound healing in diabetic models.

Through the joint action of EDC/NHS and methylpropionylated heparin, we constructed an NT-3 improved scaffold; increased the drug loading capacity, stability of controlled drug release, and cell proliferation; and activated the mRNA of target molecules related to the NT-3/TrkC pathway, such as TrkC, NF-200, and MAP-2. Most importantly, they promoted the expression of neural-related proteins (NF-200 and MAP-2).

We first investigated the molecular mechanism of NT-3 cross-linked scaffolds to promote the differentiation of BMSCs into neurons and concluded that NT-3, as a target molecule in the NT-3/TrkC pathway, promotes the differentiation of BMSCs into neurons. According to this theory, we used the combined application of EDC/NHS and heparin to prepare NT-3-modified scaffolds, which effectively increased the drug loading and controlled-release efficiency of NT-3, promoted the differentiation of BMSCs into neurons, and provided a new idea for spinal cord repair.

This research was sponsored by Natural Science Foundation of Chongqing (Grant No. cstc2020jcyj-msxmX0278). It was also sponsored by the Science and Technology Planning project contract of Yubei District, Chongqing (Application technology research-invention and achievement transformation special project), Contract number: 2021(研)26. We are grateful to the staff at Xinqiao Hospital for providing the animal’s tissues for our experiment.

The authors have no conflicts to disclose.

The cell lines were procured. All animal experimental protocols were approved by the Review Committee for the Use of Animal Subjects of Army Medical University (animal production license number: SCXK(渝)20170002; animal handling license number: SCXK(渝)20170002).

Tao Jiang: Data curation (lead); Formal analysis (equal); Investigation (equal); Methodology (equal); Validation (lead). Hong Yin: Formal analysis (equal); Methodology (equal); Writing – original draft (equal). Miao Yu: Writing – original draft (equal). Han Wang: Writing – review & editing (equal). Hui Xing: Conceptualization (lead); Formal analysis (equal); Funding acquisition (lead); Investigation (equal); Project administration (lead); Writing – review & editing (equal).

The data that support the findings of this study are available from the corresponding author upon reasonable request.